circad | circRNAs associated with diseases

mmu_circRNA_001135
Gene	SAMD8	Organism	Mouse
Genome Locus	n/a	Build	n/a
Disease	Myocardial infarction induced heart failure	ICD-10	Cardiovascular disease, unspecified (I51.6)
DBLink	Link to database	PMID	27336675
Experimental Method
Sample Type	Heart Ventricles	Comparison	Ten mice each group were euthanized and 20 mg left ventricular tissues was collected and stored in liquid nitrogen
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CTTTACCATGTTTGTGACCTC Reverse GAACCAGGATCCAAATGTA	Statistics	Fold Change : Downregulated,1.771 pvalue : p=0.03
Citation
Wu, HJ, Zhang, CY, Zhang, S, Chang, M, Wang, HY (2016). Microarray Expression Profile of Circular RNAs in Heart Tissue of Mice with Myocardial Infarction-Induced Heart Failure. Cell. Physiol. Biochem., 39, 1:205-16.